Class 12

Punjab State Board PSEB 12th Class Biology Book Solutions Chapter 13 Organisms and Populations Textbook Exercise Questions and Answers.

PSEB Solutions for Class 12 Biology Chapter 13 Organisms and Populations

PSEB 12th Class Biology Guide Organisms and Populations Textbook Questions and Answers

Question 1.
How is diapause different from hibernation?
Answer:
Diapause is a stage of suspended development to cope with unfavourable conditions. Many species of Zooplankton and insects exhibit diapause to tide over adverse climatic conditions during their development. Hibernation or winter sleep is a resting stage wherein animals escape winters of cold) by hiding themselves in their shelters. They escape the winter season by entering a state of inactivity by slowing their metabolism. The phenomenon of hibernation is exhibited by bats, squirrels, and other rodents.

Question 2.
If a marine fish is placed in a freshwater aquarium, will the fish be able to survive? Why or why not?
Answer:
If a marine fish is placed in a freshwater aquarium, then its chances of survival will diminish. This is because their bodies are adapted to high salt concentrations of the marine environment. In freshwater conditions, they are unable to regulate the water entering their body (through osmosis). Water enters their body due to the hypotonic environment outside. This results in the swelling up of the body, eventually leading to the death of the marine fish.

Question 3.
Define phenotypic adaptation. Give one example.
Answer:
Phenotypic adaptation involves changes in the body of an organism in response to genetic mutation or certain environmental changes. These responsive adjustments occur in an organism in order to cope with environmental conditions present in their natural habitats. For example, desert plants have thick cuticles and sunken stomata on the surface of their leaves to prevent transpiration. Similarly, elephants have long ears that act as thermoregulators.

Question 4.
Most living organisms cannot survive at temperatures above 45°C. How are some microbes able to live in habitats with temperatures exceeding 100°C?
Answer:
Archaebacteria (Thermophiles) are ancient forms of bacteria found in hot water springs and deep-sea hydrothermal vents. They are able to survive in high temperatures (which far exceed 100°C) because their bodies have adapted to such environmental conditions. These organisms contain specialised thermo-resistant enzymes, which carry out metabolic functions that do not get destroyed at such high temperatures.

Question 5.
List the attributes that populations but not individuals possess.
Answer:
A population can be defined as a group of individuals of the same species residing in a particular geographical area at a particular time and functioning as a unit. For example, all human beings living at a particular place at a particular time constitute the population of humans.

The main attributes or characteristics of a population residing in a given area are as follows :
(a) Birth Rate (Natality): It is the ratio of live births in an area to the population of an area. It is expressed as the number of individuals added to the population with respect to the members of the population.

(b) Death Rate (Mortality): It is the ratio of deaths in an area to the population of an area. It is expressed as the loss of individuals with respect to the members of the population.

(c) Sex Ratio: It is the number of males or females per thousand individuals.

(d) Age Distribution: It is the percentage of individuals of different ages in a given population. At any given time, the population is composed of individuals that are present in various age groups. The age distribution pattern is commonly represented through age pyramids.

(e) Population Density: It is defined as the number of individuals of a population present per unit area at a given time.

Question 6.
If a population growing exponentially double in size in 3 years, what is the intrinsic rate of increase (r) of the population?
Answer:
A population grows exponentially if sufficient amounts of food resources are available to the individual. Its exponential growth can be calculated by the following integral form of the exponential growth equation:
N_t = N₀e^rt
where,
N_t = Population density after time t
N₀= Population density at time zero
r = Intrinsic rate of natural increase
e = Base of natural logarithms (2.71828)

From the above equation, we can calculate the intrinsic rate of increase (r) of a population.
Now, as per the question,
Present population density = x
Then, population density after two years = 2x
t = 3 years
Substituting these values in the formula, we get
⇒ 2x = x e^3r
⇒ 2 = e^3r

Applying log on both sides,
⇒ log2 = 3r log e
⇒ \(\frac{\log 2}{3 \log e}\) = r

Hence, the intrinsic rate of increase for the above-illustrated population is 0.2311.

Question 7.
Name important defence mechanisms in plants against herbivory.
Answer:
Several plants have evolved various defence mechanisms both morphological and chemical to protect themselves against herbivory,
(1) Morphological Defence Mechanisms

• Cactus leaves (Opuntia) are modified into sharp spines (thorns) to deter herbivores from feeding on them.
• Sharp thorns along with leaves are present in Acacia to deter herbivores.
• In some plants, the margins of their leaves are spiny or have sharp edges that prevent herbivores from feeding on them.

(2) Chemical Defence Mechanisms

• All parts of Calotropis weeds contain toxic cardiac glycosides, which can prove to be fatal if ingested by herbivores.
• Chemical substances such as nicotine, caffeine, quinine, and opium are produced in plants as a part of self-defence.

Question 8.
An orchid plant is growing on the branch of mango tree. How do you describe this interaction between the orchid and the mango t tree?
Answer:
An orchid plant growing on the branch of a mango tree is an epiphyte. f Epiphytes are plants growing on other plants which however, do not derive nutrition from them. Therefore, the relationship between a mango tree and an orchid is an example of commensalisms, where one species gets benefited while the other remains unaffected. In the above interaction, the orchid is benefited as it gets support while the mango tree remains unaffected.

Question 9.
What is the ecological principle behind the biological control method of managing with pest insects?
Answer:
The basis of various biological control methods is on the concept of predation. Predation is a biological interaction between the predator and the prey, whereby the predator feeds on the prey. Hence, the predators regulate the population of preys in a habitat, thereby helping in the management of pest insects.

Question 10.
Distinguish between the following:
(a) Hibernation and Aestivation
(b) Ectotherms and Endotherms
Answer:
(a) Hibernation and Aestivation

Hibernation	Aestivation
1. Hibernation is a state of reduced activity in some organisms to escape cold winter conditions.	Aesrivarion is a state of reduced activity in some organisms to escape desiccation due to heat in summers.
2. Bears and squirrels inhabiting cold regions are examples of animals that hibernate during winters.	Fishes and snails are examples of organisms aestivating during summers.

(b) Ectotherms and Endotherms

Ectotherms	Endotherms
1. Ectotherms ate cold-blooded animals. Their temperature varies with their surroundings.	Endotherms are warm-blooded animals. They maintain a constant body temperature.
2. Fishes, amphibians, and reptiles are ectothermic animals.	birds and mammals are endothermal animals.

Question 11.
Write a short note on
(a) Adaptations of Desert Plants and Animals
(b) Adaptations of plants to water scarcity
(c) Behavioural adaptations in animals
(d) Importance of light to plants
(e) Effect of temperature or water scarcity and the adaptations of animals.
Answer:
(a) Adaptations of Desert Plants and Animals
(i) Adaptations of Desert Plants: Plants found in deserts are well adapted to cope with harsh desert conditions such as water scarcity and scorching heat. Plants have an extensive root system to tap underground water. They bear thick cuticles and sunken stomata o.i the surface of their leaves to reduce transpiration.

In Opuntia, the leaves are entirely modified into spines and photosynthesis is carried out by green stems. Desert plants have special pathways to synthesise food, called CAM (C₄ pathway). It enables the stomata to remain closed during the day to reduce the loss of water through transpiration.

(ii) Adaptations of Desert Animals: Animals found in deserts such as desert kangaroo rats, lizards, snakes, etc. are well adapted to their habitat. The kangaroo rat found in the deserts of Arizona never drinks water in its life. It has the ability to concentrate its urine to conserve water. Desert lizards and snakes bask in the sun during early morning and burrow themselves in the sand during afternoons to escape the heat of the day. These adaptations occur in desert animals to prevent the loss of water.

(b) Adaptations of Plants to Water Scarcity: Plants found in deserts are well adapted to cope with water scarcity and scorching heat of the desert. Plants have an extensive root system to tap underground water. They bear thick cuticles and sunken stomata on the, surface of their leaves to reduce transpiration. In Opuntia, the leaves are modified into
spines and the process of photosynthesis is carried out by green stems. Desert plants have special pathways to synthesise food, called CAM. (C₄ pathway). It enables their stomata to remain closed during the day to reduce water loss by transpiration.

(c) Behavioural Adaptations in Animals: Certain organisms are affected by temperature variations. These organisms undergo adaptations such as hibernation, aestivation, migration, etc. to escape environmental stress to suit their natural habitat. These adaptations in the behaviour of an organism are called behavioural adaptations. For example, ectodermal animals and certain endotherms exhibit behavioural adaptations. Ectotherms are cold-blooded animals such as fish, amphibians, reptiles, etc.

Their temperature varies with their surroundings. For example, the desert lizard basks in the sun during early hours when the temperature is quite low. However, as the temperature begins to rise, the lizard burrows itself inside the sand to escape the scorching sun. Similar burrowing strategies are exhibited by other desert animals. Certain endotherms (warm-blooded animals) such as birds and mammals escape cold and hot weather conditions by hibernating during winters and aestivating during summers. They hide themselves in shelters such as caves, burrows, etc. to protect against temperature variations.

(d) Importance of Light to Plants: Sunlight acts as the ultimate source of energy for plants. Plants are autotrophic organisms, which need light for carrying out the process of photosynthesis. Light also plays an important role in generating photoperiodic responses! occurring in plants. Plants respond to changes in intensity of light
during various seasons to meet their photoperiodic requirements for flowering. Light also plays an important role in aquatic habitats for ‘ vertical distribution of plants in the sea.

(e) Effect of Temperature or Water Scarcity and the Adaptations of Animals: Temperature is the most important
ecological factor. Average temperature on the Earth varies from one place to another. These variations in temperature affect the distribution of animals on the Earth. Animals that can tolerate a wide range of temperature are called eurythermal. Those which can tolerate a narrow range of temperature are called stenothermal animals.

Animals also undergo adaptations to suit their natural habitats. For example, animals found in colder areas have shorter ears and limbs that prevent the loss of heat from their body. Also, animals found in Polar regions have thick layers of fat below their skin and thick coats of fur to prevent the loss of heat.

Some organisms exhibit various behavioural changes to suit their natural habitat. These adaptations present in the behaviour of an organism to escape environmental stresses are called behavioural adaptations. For example, desert lizards are ectotherms. This means that they do not have a temperature regulatory mechanism to escape temperature variations.

Question 12.
List the various abiotic environmental factors.
Answer:
All non-living components of an ecosystem form abiotic components. It includes factors such as temperature, water, light, and soil.

Question 13.
Give an example for:
(a) An endothermic animal
(b) An ectothermic animal
(c) An organism of benthic zone
Answer:
(a) Endothermic Animal: Birds such as crows, sparrows, pigeons, cranes, etc. and mammals such as bears, cows, rats, rabbits, etc. are endothermic animals.

(b) Ectothermic Animal: Fishes such as sharks, amphibians such as frogs, and reptiles such as tortoises, snakes, and lizards are ectothermic animals.

(c) Organism of Benthic Zone: Decomposing bacteria is an example of an organism found in the benthic zone of a water body.

Question 14.
Define population and community.
Answer:
Population: A population can be defined as a group of individuals of the same species residing in a particular geographical area at a particular time and functioning as a unit. For example, all human beings living at a particular place at a particular time constitute the population of humans.

Community: A community is defined as a group of individuals of different species, living within a certain geographical area. Such individuals can be similar or dissimilar, but cannot reproduce with the members of other species.

Question 15.
Define the following terms and give one example for each:
(a) Commensalism
(b) Parasitism
(c) Camouflage
(d) Mutualism
(e) Interspecific competition
Answer:
(a) Commensalism: Commensalism is an interaction between two species in which one species gets benefited while the other remains unaffected. An orchid growing on the branches of a mango tree and barnacles attached to the body of whales are examples of commensalisms.

(b) Parasitism: It is an interaction between two species in which one species (usually smaller) gets positively affected, while the other species (usually larger) is negatively affected. An example of this is liver fluke. Liver fluke is a parasite that lives inside the liver of the host body and derives nutrition from it. Hence, the parasite is benefited as it derives nutrition from the host, while the host is negatively affected as the parasite reduces the host fitness, making its body weak.

(c) Camouflage: It is a strategy adopted by prey species to escape their predators. Organisms are cryptically coloured so that they can easily mingle in their surroundings and escape their predators. Many species of frogs and insects camouflage in their surroundings and escape their predators.

(d) Mutualism: It is an interaction between two species in which both species involved are benefited. For example, lichens show a mutual symbiotic relationship between fungi and blue-green algae, where both are equally benefited from each other.

(e) Interspecific Competition: It is an interaction between individuals of different species where both species get negatively affected. For example, the competition between flamingoes and resident fishes in South American lakes for common food resources i.e., zooplankton.

Question 16.
With the help of suitable diagram describe the logistic population growth curve.
Answer:
The logistic population growth curve is commonly observed in yeast cells that are grown under laboratory conditions. It includes five phases: the lag phase, positive acceleration phase, exponential phase, negative acceleration phase, and stationary phase.
(a) Lag Phase: Initially, the population of the yeast cell is very small. This is because of the limited resource present in the habitat.

(b) Positive Acceleration Phase: During this phase, the yeast cell adapts to the new environment and starts increasing its population. However, at the beginning of this phase, the growth of the cell is very limited.

(c) Exponential Phase: During this phase, the population of the yeast cell increases suddenly due to rapid growth. The population grows exponentially due to the availability of sufficient food resources, constant environment, and the absence of any interspecific competition. As a result, the curve rises steeply upwards.

(d) Negative Acceleration Phase: During this phase, the
environmental resistance increases and the growth rate of the population decreases. This occurs due to an increased competition among the yeast cells for food and shelter.

(e) Stationary Phase: During this phase, the population becomes stable. The number of cells produced in a population equals the number of cells that die. Also, the population of the species is said to have reached nature’s carrying capacity in its habitat.

A Verhulst-pearl logistic curve is also known as an S-Shaped growth curve.

Question 17.
Select the statement which explains best parasitism.
(a) One organism is benefited.
(b) Both the organisms are benefited.
(c) One organism is benefited, other is not affected.
(d) One organism is benefited, other is affected.
Answer:
(d) One organism is benefited, other is affected.
Parasitism is an interaction between two species in which one species (parasite) derives benefit while the other species (host) is harmed. For example, ticks and lice (parasites) present on the human body represent this interaction wherein the parasites receive benefit (as they derive nourishment by feeding on the blood of humans). On the other hand, these parasites reduce host fitness and cause harm to the human body.

Question 18.
List any three important characteristics of a population and explain.
Answer:
A population can be defined as a group of individuals of the same species, residing in a particular geographical area at a particular time and functioning as a unit. For example, all human beings living at a particular place at a particular time constitute the population of humans.
Three important characteristics of a population are as follows :
(a) Birth Rate (Natality): It is the ratio of live births in an area to the population of an area. It is expressed as the number of individuals added to the population with respect to the members of the population.

(b) Death Rate (Mortality): It is the ratio of deaths in an area to the population of an area. It is expressed as the loss of individuals with respect to the members of the population.

(c) Age Distribution: It is the percentage of individuals of different ages in a given population. At any given time, a population is composed of individuals that are present in various age groups. The age distribution pattern is commonly represented through a^e pyramids.

Punjab State Board PSEB 12th Class Biology Book Solutions Chapter 14 Ecosystem Textbook Exercise Questions and Answers.

PSEB Solutions for Class 12 Biology Chapter 14 Ecosystem

PSEB 12th Class Biology Guide Ecosystem Textbook Questions and Answers

Question 1.
Fill in the blanks.
(a) Plants are called as ……………………………. because they fix carbon dioxide.
(b) In an ecosystem dominated by trees, the pyramid (of numbers) is ………………….. type.
(c) In aquatic ecosystems, the limiting factor for the productivity is ………………………. .
(d) Common detritivores in our ecosystem are …………………………. .
(e) The major reservoir of carbon on earth is …………………………….. .
Answer:
(a) autotrophs
(b) inverted
(c) light
(d) earthworms
(e) oceans.

Question 2.
Which one of the following has the largest population in a food chain?
(a) Producers
(b) Primary consumers
(c) Secondary consumers
(d) Decomposers
Answer:
(a) Producers (decomposers can be maximum but they are excluded from the food chain ).

Question 3.
The second trophic level in a lake is
(a) Phytoplankton
(b) Zooplankton
(c) Benthos
(d) Fishes
Answer:
(b) Zooplankton
Zooplankton are primary consumers in aquatic food chains that feed upon phytoplankton. Therefore, they are present at the second trophic level in a lake.

Question 4.
Secondary producers are
(a) Herbivores
(b) Producers
(c) Carnivores
(d) None of the above
Answer:
(d) None of the above
Plants are the only producers. Thus, they are called primary producers. There are no other producers in a food chain.

Question 5.
What is the percentage of photosynthetically active radiation (PAR) in the incident solar radiation?
(a) 100%
(b) 50 %
(c) 1-5%
Answer:
(b) 50%
Out of total incident solar radiation, about fifty percent of it forms photosynthetically active radiation or PAR.

Question 6.
Distinguish between
(a) Grazing food chain and detritus food chain
(b) Production and decomposition
(c) Upright and inverted pyramid
(d) Food chain and Food web
(e) Litter and detritus
(f) Primary and secondary productivity
Answer:
(a) Grazing food chain and detritus food chain

Grazing food chain	Detritus food chain
1. In this food chain, energy is derived from the Sun.	In this food chain, energy comes from organic matter (or detritus) generated in trophic levels of the grazing food chain.
2. It begins with producers, present at the first trophic level. The plant biomass is then eaten by herbivores, which in turn are consumed by a variety of carnivores.	begins with detritus such as dead bodies of animals or fallen leaves, which are then eaten by decomposers or detrivores. These detritivores are in turn consumed by their predators.
3. This food chain is usually large.	It is usually smaller as compared to the grazing food chain.

(b) Production and decomposition

Production	Decomposition
1. It is the rare of producing organic matter (food) by producers.	It is the process of breaking down of complex organic matter or biomass from the body of dead plants and animals with the help of decomposers into organic raw material such as CO2, H2O and other nutrients.
2. It depends on the photosynthetic cápacity of the producers.	It occurs with the help of decomposers.
3. Sunlight is required by plants for primary production.	Sunlight is not required for decomposition by clecomposers.

(c) upright and inverted pyramid

Upright pyramid	Inverted pyramid
1. The pyramid of energy is upright.	always The pyramid of biomass and the pyramid of, numbers can be inverted.
2. In the upright pyramid, the number and biomass of organisms in the producer level of an ecosystem is the highest, which keeps on decreasing at each trophic level in a food chain.	In an inverted pyramid, the number and biomass of organisms in the producer level of an ecosystem is the lowest, which keeps on increasing at each tropic level.

(d) Food chain and food web

Food chain	Food web
1. The transfer of energy from producers to top consumers through a series of organisms is called food chain.	A number of food chain inter-connected with each other forming a web-like pattern is called food web.
2. One organism holds only one position.	One organism can hold more than one position.
3. The flow of energy can be easily calculated.	The flow of energy is very difficult to calculate.
4. It is always straight and proceed in a progressive straight line.	Instead of straight line, it is a series of branching lines.
5. Competition is limited to members of same trophic level.	Competition is amongst members of same and different trophic levels.

(e) Litter and detritus

Litter	Detritus
l. It is made of dried fallen plant matter.	It is freshly deposited organic matter, i. e. remains of plants and animals.
2. It is found above the ground.	It is found both above and below the ground.

(f) Primary and secondary productivity

Primary productivity	Secondary_productivity
1. Primary productivity is the amount of energy accumulation or amount of biomass produced per unit area over a time period.	Secondary productivity is the rate of formation of new organic matter by consumer.
2.  It is of two types, gross primary productivity (GPP) and net primary productivity (NPP). They are related as: GPP – R = NPP, where R is respiratory losses.	It is also of two types gross secondary productivity (GSP) and net secondary productivity (NSP). They are related as: NSP = GSP – R Where R is respiratory losses.

Question 7.
Describe the components of an ecosystem.
Answer:
An ecosystem is defined as an interacting unit that includes both the biological community as well as the non-living components of an area. The living and the non-living components of an ecosystem interact amongst themselves and function as a unit, which gets evident during the processes of nutrient cycling, energy flow, decomposition, and productivity. There are many ecosystems such as ponds, forests, grasslands, etc.

The two components of an ecosystem are as follows :
(a) Biotic Component: It is the living component of an ecosystem that includes biotic factors such as producers, consumers, decomposers, etc. Producers include plants and algae. They contain chlorophyll pigment, which helps them carry out the process of photosynthesis in the presence of light.

Thus, they are also called converters or transducers. Consumers or heterotrophs are organisms that are directly (primary consumers) or indirectly (secondary and tertiary consumers) dependent on producers for their food. Decomposers include micro-organisms such as bacteria and fungi. They obtain nutrients by breaking down the remains of dead plants and animals.

(b) Abiotic Component: They are the non-living component of an ecosystem such as light, temperature, water, soil, air, inorganic nutrients, etc.

Question 8.
Define ecological pyramids and describe with examples, pyramids of number and biomass.
Answer:
An ecological pyramid is a graphical representation of various ecological parameters such as the number of individuals present at each trophic level, the amount of energy, or the biomass present at each trophic level.
Ecological pyramids represent producers at the base, while the apex represents the top-level consumers present in the ecosystem.
There are three types of pyramids:

1. Pyramid of numbers
2. Pyramid of energy
3. Pyramid of biomass

1. Pyramid of Numbers: It is a graphical representation of the number of individuals present at each trophic level in a food chain of an ecosystem. The pyramid of numbers can be upright or inverted depending on the number of producers. For example, in a grassland ecosystem, the pyramid of numbers is upright.

In this type of a food chain, the number of producers (plants) is followed by the number of herbivores (mice), which in turn is followed by the number of secondary consumers (snakes) and tertiary carnivores (eagles). Hence, the number of individuals at the producer level will be the maximum, while the number of individuals present at top carnivores will be least.

On the other hand, in a parasitic food chain, the pyramid of numbers is inverted. In this type of a food chain, a single tree (producer) provides food to several fruit-eating birds, which in turn support several insect species.

2. Pyramid of Biomass: A pyramid of biomass is a graphical representation of the total amount of living matter present at each trophic level of an ecosystem. It can be upright or inverted. It is upright in grasslands and forest ecosystems as the amount of biomass present at the producer level is higher than at the top carnivore level.
The pyramid of biomass is inverted in a pond ecosystem as the biomass of fishes far exceeds the biomass of zooplankton (upon which they feed).

Question 9.
What is primary productivity? Give brief description of factors that affect primary productivity.
Answer:
It is defined as the amount of organic matter or biomass produced by producers per unit area over a period of time. Primary productivity of an ecosystem depends on the variety of environmental factors such as light, temperature, water, precipitation, etc. It also depends on the availability of nutrients and the availability of plants to carry out photosynthesis.

Question 10.
Define decomposition and describe the processes and products of decomposition.
Answer:
Decomposition is the process that involves the breakdown of complex organic matter or biomass from the body of dead plants and animals with the help of decomposers into inorganic raw materials such as carbon dioxide, water, and other nutrients. The various processes involved in decomposition are as follows :
1. Fragmentation: It is the first step in the process of decomposition. It involves the breakdown of detritus into smaller pieces by the action of detritivores such as earthworms.

2. Leaching: It is a process where the water-soluble nutrients go down into the soil layers and get locked as unavailable salts.

3. Catabolism: It is a process in which bacteria and fungi degrade detritus through various enzymes into smaller pieces.

4. Humification: The next step is humification which leads to the formation of a dark-colored colloidal substance called humus, which acts as reservoir of nutrients for plants.

5. Mineralisation: The humus is further degraded by the action of microbes, which finally leads to the release of inorganic nutrients into the soil. This process of releasing inorganic nutrients from the humus is known as mineralization.

Decomposition produces a dark-colored, nutrient-rich substance called humus. Humus finally degrades and releases inorganic raw materials such as C02, water, and other nutrients in the soil.

Question 11.
Give an account of energy flow in an ecosystem.
Answer:
Energy enters an ecosystem from the Sun. Solar radiations pass through the atmosphere and are absorbed by the Earth’s surface. These radiations help plants in carrying out the process of photosynthesis.
Also, they help maintain the Earth’s temperature for the survival of living organisms. Some solar radiations are reflected by the Earth’s surface.

Only 2-10% of solar energy is captured by green plants (producers) during photosynthesis to be converted into food.
The rate at which the biomass is produced by plants during photosynthesis is termed as ‘gross primary productivity.
When these green plants are consumed by herbivores, only 10% of the stored energy from producers is transferred to herbivores. The remaining 90 % of this energy is used by plants for various processes such as respiration, growth, and reproduction. Similarly, only 10% of the energy of herbivores is transferred to carnivores. This is known as ten percent law of energy flow.

Question 12.
Write important features of a sedimentary cycle in an ecosystem.
Answer:
Sedimentary cycles have their reservoirs in the Earth’s crust or rocks. Nutrient elements are found in the sediments of the Earth. Elements such as sulphur, phosphorus, potassium, and calcium have sedimentary cycles.
Sedimentary cycles are very slow. They take a long time to complete their circulation and are considered as less perfect cycles. This is because during recycling, nutrient elements may get locked in the reservoir pool, thereby taking a very long time to come out and continue circulation. Thus, it usually goes out of circulation for a long time.

Question 13.
Outline salient features of carbon cycling in an ecosystem.
Answer:
The carbon cycle is an important gaseous cycle which has its reservoir pool in the atmosphere.
All living organisms contain carbon as a major body constituent. Carbon is a fundamental element found in all living forms. All biomolecules such as carbohydrates, lipids, and proteins required for life processes are made of carbon.
Carbon is incorporated into living forms through a fundamental process called ‘photosynthesis’.

Photosynthesis uses sunlight and atmospheric carbon dioxide to produce a carbon compound called ‘glucose’.
This glucose molecule is utilised by other living organisms. Thus, atmospheric carbon is incorporated in living forms.
Now, it is necessary to recycle this absorbed carbon dioxide back into the atmosphere to complete the cycle.

There are various processes by which carbon is recycled back into the atmosphere in the form of carbon dioxide gas.
The process of respiration breaks down glucose molecules to produce carbon dioxide gas. The process of decomposition also releases carbon dioxide from dead bodies of plants and animals into the atmosphere. Combustion of fuels, industrialization, deforestation, volcanic eruptions and forest fires act as other major sources of carbon dioxide.

Punjab State Board PSEB 12th Class Biology Book Solutions Chapter 12 Biotechnology and its Applications Textbook Exercise Questions and Answers.

PSEB Solutions for Class 12 Biology Chapter 12 Biotechnology and its Applications

PSEB 12th Class Biology Guide Biotechnology and its Applications Textbook Questions and Answers

Question 1.
Crystals of Bt toxin produced by some bacteria do not kill the bacteria themselves because
(a) bacteria are resistant to the toxin,
(b) toxin is immature,
(c) toxin is inactive,
(d) bacteria encloses toxin in a special sac.
Answer:
Toxin is inactive: In bacteria, the toxin is present in an inactive form, called prototoxin, which gets converted into active form when it enters the body of an insect.

Question 2.
What are transgenic bacteria? Illustrate using any one example.
Answer:
Transgenic bacteria contain foreign gene that is intentionally introduced into its genome. They are manipulated to express the desirable gene for the production of various commercially important products.

An example of transgenic bacteria is E.coli. In the plasmid of E.coli, the two DNA sequences corresponding to A and B chain of human insulin are inserted, so as to produce the respective human insulin chains. Hence, after the insertion of insulin gene into the bacterium, it becomes transgenic and starts producing chains of human insulin. Later on, these chains are extracted from E.coli and combined to form human insulin.

Question 3.
Compare and contrast the advantages and disadvantages of production of genetically modified crops.
Answer:
The production of genetically modified (GM) or transgenic crops has several advantages.

• Most of the GM crops have been developed for pest resistance, which increases the crop productivity and therefore, reduces the reliance on chemical pesticides.
• Many varieties of GM food crops have been developed, which have enhanced nutritional quality. For example, golden rice is a transgenic variety of rice, which is rich in vitamin A.
• These plants prevent the loss of fertility of soil by increasing the ‘
  efficiency of mineral usage.
• They are highly tolerant to unfavourable abiotic conditions.
• The use of GM crops decreases the post harvesting loss of crops.

However, there are certain controversies regarding the use of genetically modified crops around the world. The use of these crops can affect the native biodiversity in an area. For example, the use of Bt toxin to decrease the amount of pesticide is posing a threat for beneficial insect pollinators such as honey bee. If the gene expressed for Bt toxin gets expressed in the pollen, then the honey bee might be affected. As a result, the process of pollination by honey bees would be affected. Also, genetically modified crops are affecting human health. They supply allergens and certain antibiotic resistance markers in the body. Also, they can cause genetic pollution in the wild relatives of the crop plants. Hence, it is affecting our natural environment.

Question 4.
What are Cry proteins? Name an organism that produce it. How has man exploited this protein to his benefit?
Answer:
Cry proteins are encoded by cry genes. These proteins are toxins, which are produced by Bacillus thuringiensis bacteria. This bacterium contains these proteins in their inactive form. When the inactive toxin protein is ingested by the insect, it gets activated by the alkaline pH of the gut. This results in the lysis of epithelial cell and eventually the death of the insect. Therefore, man has exploited this protein to develop certain transgenic crops with insect resistance such as Bt cotton, Bt corn, etc.

Question 5.
What is gene therapy? Illustrate using the example of adenosine deaminase (ADA) deficiency.
Answer:
Gene therapy is a technique for correcting a defective gene through gene manipulation. It involves the delivery of a normal gene into the individual to replace the defective gene, for example, the introduction of gene for adenosine deaminase (ADA) in ADA deficient individual. The adenosine deaminase enzyme is important for the normal functioning of the immune system. The individual suffering from this disorder can be cured by transplantation of bone marrow cells. The first step involves the extraction of lymphocyte from the patient’s bone marrow. Then, a functional gene for ADA is introduced into lymphocytes with the help of retrovirus. These treated lymphocytes containing ADA gene are then introduced into the patient’s bone . marrow. Thus, the gene gets activated producing functional T-lymphocytes and activating the patient’s immune system.

Question 6.
Diagrammatically represent the experimental steps in cloning and expressing an human gene (say the gene for growth hormone) into a bacterium like E. coli ?
Answer:
DNA cloning is a method of producing multiple identical copies of specific template DNA. It involves the use of a vector to carry the specific foreign DNA fragment into the host cell. The mechanism of cloning and transfer of gene for growth hormone into E.coli is represented below:

Question 7.
Can you suggest a method to remove oil (hydrocarbon) from seeds based on your understanding of rDNA technology and chemistry of oil?
Answer:
Recombinant DNA technology (rDNA) is a technique used for manipulating the genetic material of an organism to obtain the desired result. For example, this technology is used for removing oil from seeds. The constituents of oil are glycerol and fatty acids. Using rDNA, one can obtain oilless seeds by preventing the synthesis of either glycerol or fatty acids. This( is done by removing the specific gene responsible for the synthesis.

Question 8.
Find out from internet what is golden rice.
Answer:
Golden rice is a genetically modified variety of rice, Oryza sativa, which has been developed as a fortified food for areas where there is a shortage of dietary vitamin A. It contains a precursor of pro-vitamin A, called beta-carotene, which has been introduced into the rice through genetic engineering. The rice plant naturally produces beta-carotene pigment in its leaves. However, it is absent in the endosperm of the seed. This is because beta-carotene pigment helps in the process of photosynthesis while photosynthesis does not occur in endosperm.

Since beta-carotene is a precursor of pro-vitamin A, it is introduced into the rice variety to fulfil the shortage of dietary vitamin A. It is simple and a less expensive alternative to vitamin supplements. However, this variety of rice has faced a significant opposition from environment activists. Therefore, they are still not available in market for human consumption.

Question 9.
Does our blood have proteases and nucleases?
Answer:
No, human blood does not include the enzymes, nucleases and proteases. In human beings, blood serum contains different types of protease inhibitors, which protect the blood proteins from being broken down by the action of proteases. The enzyme, nucleases, catalyses the hydrolysis of nucleic acids that is absent in blood.

Question 10.
Consult internet and find out how to make orally active protein pharmaceutical. What is the major problem to be encountered?
Answer:
Orally active protein pharmaceutical can be made by lining it with a substance that will dissolve after it has passed through the stomach.
The major problem encountered is that the stomach enzymes and acids may denature the therapeutic protein and render it ineffective.

Punjab State Board PSEB 12th Class Biology Book Solutions Chapter 11 Biotechnology: Principles and Processes Textbook Exercise Questions and Answers.

PSEB Solutions for Class 12 Biology Chapter 11 Biotechnology: Principles and Processes

PSEB 12th Class Biology Guide Biotechnology: Principles and Processes Textbook Questions and Answers
Question 1.
Can you list 10 recombinant proteins which are used in medical ; practice? Find out where they are used as therapeutics (use the internet).
Answer:

Recombinant proteins	Therapeutic uses
(a) Insulin	Used for diabetes mellitus
(b) OKT-3	Therapeutic antibody, used for reversal
(c) DNase	Treatment of cystic fibrosis
(d) Reo Pro	Prevention of blood clots
(e) Blood clotting factor VIII	Treatment of haemophilia A
(f) Blood clotting factor IX	Treatment of haemophilia B
(g) Tissue plasminogen activator	For acute myocardial infarction
(h) Interferon alpha (INF alpha)	Used for hepatitis C
(i) Interferon beta (INF beta)	Used for multiple sclerosis
(j) Interferon gamma (INF gamma)	Used for granulomatous disease

Question 2.
Make a chart (with diagrammatic representation) showing a restriction enzyme, the substrate DNA on which it acts, the site at which it cuts DNA and the product it produces.
Answer:

Question 3.
From what you have learnt, can you tell whether enzymes are bigger or DNA is bigger in molecular size? How did you know?
Answer:
The molecular size of DNA molecules is more than that of enzymes. It is because an enzyme (protein) is synthesised from a segment of DNA called the gene.

Question 4.
What would be the molar concentration of human DNA in a human cell? Consult your teacher.
Answer:
The molar concentration of human DNA in a human diploid cell is as follows:
Total number of chromosomes × 6.023 × 10²³
= 46 × 6.023 × 10²³
= 2.77 × 1018moles

Question 5.
Do eukaryotic cells have restriction endonucleases? Justify your answer.
Answer:
No. Eukaryotic cells do not have restriction endonucleases. All the restriction endonucleases have been isolated from the various strains of bacteria and they are also named according to the genus and species of prokaryotes. The first letter of the enzyme comes from the genus and the second two letters come from the species of the prokaryotic cell from which they have been isolated. For example, EcoRI comes from Escherichia coliRY 13. In EcoRI, the letter ‘R’ is derived from the name of the strain. Roman numbers following the names indicate the order in which the enzymes were isolated from that strain of bacteria.

Question 6.
Besides better aeration and mixing properties, what other advantages do stirred tank bioreactors have over shake flasks?
Answer:
Shake flasks are used for growing microbes and mixing the desired materials on a small scale in the laboratory. However, the large-scale production of a desired biotechnological product requires large stirred tank bioreactors.

Besides better aeration and mixing properties, bioreactors have the following advantages:

• It has an oxygen delivery system.
• It has a foam control, temperature and pH control system.
• Small volumes of culture can be withdrawn periodically.

Question 7.
Collect 5 examples of palindromic DNA sequences by consulting your teacher. Better try to create a palindromic sequence by following base-pair rules.
Answer:
Some palindromic DNA sequences and the restriction enzymes which act on them are as follows :

• 5′-AGCT-3′ Alul (Arthrobacter luteus)
  3′-TCGA-5′
• 5′-GAATTC-3′ EcoRI (Escherichia coli)
  3′-CTTAAG-5′
• 5′-AAGCTT-3′ Hindlil (Haemophilus influenzae)
  3′-TTCGAA-5′
• 5′-GTCGAC-3′ Sail (Streptomyces albus)
  3′-CAGCTG-5′
• 5′-CTGCAG-3′ PstI (Providencia stuartii)
  3′-GACGTC-5′

Question 8.
Can you recall meiosis and indicate at what stage a recombinant DNA is made?
Answer:
A recombinant DNA is made in the pachytene stage of prophase I by f crossing over.

Question 9.
Can you think and answer how a reporter enzyme can be used to
monitor transformation of host cells by foreign DNA in addition to a selectable marker?
Answer:
Reporter enzyme can differentiate recombinants from non-recombinants on the basis of their ability to produce a specific colour in the presence of a chromogenic substrate. DNA is inserted within the coding sequence of the enzyme p-galactosidase. This results into inactivation of the enzyme which is referred to as insertional inactivation.

The presence of a chromogenic substrate gives blue-coloured colonies if the plasmid in the bacteria does not have an insert. The presence of the insert results in insertional inactivation of α-galactosidase and the colonies do not produce any colour. These are identified as recombinant colonies.

Question 10.
Describe briefly the following:
(a) Origin of replication
(b) Bioreactors
(c) Downstream processing
Answer:
(a) Origin of Replication: This is a sequence from where replication starts and any piece of DNA when linked to this sequence can be made to replicate within the host cells. This sequence is also responsible for controlling the copy number of the linked DNA. So, if one wants to recover many copies of the target DNA it should be cloned in a vector whose origin supports a high copy number.

(b) Bioreactors: Bioreactors are vessels in which raw materials are biologically converted into specific products, individual enzymes etc. using microbial plant, animal or human cells. A bioreactor provides the optimal conditions for achieving the desired product by providing optimum growth conditions (temperature, pH, substrate, salts, vitamins, oxygen). The most commonly used bioreactors are of stirring type. A biogas plant is a good example of a bioreactor.

(c) Downstream Processing: After completion of the biosynthetic stage, the product is subjected through a series of processes before it is ready for marketing as a finished product. The processes include separation and purification, which are collectively referred to as downstream processing. The product has to be formulated with suitable preservatives. Such formulation has to undergo thorough clinical trials as in the case of drugs. Strict quality control testing for each product is also required. Downstream processing and quality control testing vary from product to product.

Question 11.
Explain briefly
(a) PCR
(b) Restriction enzymes and DNA
(c) Chitinase
Answer:
(a) PCR: PCR stands for Polymerase Chain Reaction. In this reaction multiple copies of the gene (or DNA) of interest is synthesised in vitro using two sets of primers and the enzyme DNA polymerase. The enzyme extends the primers using the nucleotides provided in the reaction and the genomic DNA as template. The segment of DNA can be amplified to approximately billion times if the process of replication of DNA is repeated many times.

(b) Restriction Enzymes and DNA: Restriction enzymes are synthesised by microbes as a defence mechanism and are specifically endonucleases which cleave the double-stranded DNA with the desired genes. This activity occurs at a limited number of sites depending on the number of recognition sequences in DNA. Lysing enzymes, synthesising enzymes (DNA polymerase and reverse transcriptase) and ligases are also tools of genetic engineering.

(c) Chitinase: During the isolation of DNA in the processes of recombinant DNA technology, the fungal cell is heated with an enzyme called chitinase. The chitinase enzyme dissolves the chitin membrane to open the cell for release of DNA along with other macromolecules such as RNA, proteins, polysaccharides and lipids.

Question 12.
Discuss with your teacher and find out how to distinguish between
(a) Plasmid DNA and Chromosomal DNA
(b) RNA and DNA
(c) Exonuclease and Endonuclease
Answer:
(a)

Plasmid DNA	Chromosomal DNA
Plasmid DNA is the naked double-stranded DNA which forms a circle with no free ends. It is associated with few proteins but contains RNA polymerase enzyme. They are smaller than the host chromosomes and can be easily separated.	Chromosomal DNA is a double-stranded linear DNA molecule associated with large proteins. This DNA exists in relaxed and supercoiled forms and provides a template for replication and transcription. It has free ends represented as 3′-5′.

(b)

DNA	RNA
(i) It is mainly confined to the nucleus. A small quantity occurs in mitochondria and chloroplasts.	It mainly occurs in the cytoplasm. A small quantity is found in the nucleus.
(ii) Its quantity is constant in each cell of a species.	Its quantity varies in different cells.
(iii) It contains deoxyribose sugar.	It contains ribose sugar.
(iv) Its pyrimidines are adenine and thymine.	Its pyrimidines are adenine and uracil.
(v) The amount of adenine is equal to the amount of thymine. Also, the amount of cytosine is equal to the amount of guanine.	Adenine and uracil are not necessarily in equal amounts, nor are cytosine and guanine necessarily in equal amounts.
(vi) It can replicate itself.	It cannot replicate itself. It is formed by DNA. Some RNA viruses (paramyxo virus) can produce RNA from an RNA template.

(c) Exonucleases are nucleases which cut off the nucleotides from the 5′ or 3′ ends of a DNA molecule, whereas endonucleases are nucleases which cleave the DNA duplex at any point except at the ends.

Punjab State Board PSEB 12th Class Biology Book Solutions Chapter 10 Microbes in Human Welfare Textbook Exercise Questions and Answers.

PSEB Solutions for Class 12 Biology Chapter 10 Microbes in Human Welfare

PSEB 12th Class Biology Guide Microbes in Human Welfare Textbook Questions and Answers

Question 1.
Bacteria cannot be seen with the naked eyes, but these can be seen with the help of a microscope. If you have to carry a sample from your home to your biology laboratory to demonstrate the presence of microbes under a microscope, which sample would you carry and why?
Answer:
Curd can be used as a sample for the study of microbes. Curd contains numerous lactic acid bacteria (LAB) or Lactobacillus. These bacteria produce acids that coagulate and digest milk proteins. A small drop of curd contains millions of bacteria, which can be easily observed under a microscope.

Question 2.
Give examples to prove that microbes release gases during metabolism.
Answer:
The examples of microbes that release gases during metabolism are as follows :
(a) Bacteria and fungi carry out the process of fermentation and during this process, they release carbon dioxide. Fermentation is the process of converting a complex organic substance into a simpler substance with the action of bacteria or yeast. Fermentation of sugar produces alcohol with the release of carbon dioxide and very little energy.

(b) The dough used for making idli and dosa gives a puffed appearance. This is because of the action of bacteria which releases carbon dioxide. This CO₂ released from the dough gets trapped in the dough, thereby giving it a puffed appearance.

Question 3.
In which food would you find lactic acid bacteria? Mention some of their useful applications.
Answer:
Lactic acid bacteria can be found in curd. It is this bacterium that promotes the formation of milk into curd. The bacterium multiplies and increases its number, which converts the milk into curd. They also increase the content of vitamin B₁₂ in curd.
Lactic acid bacteria are also found in our stomach where it keeps a check on the disease-causing micro-organisms.

Question 4.
Name some traditional Indian foods made of wheat, rice and Bengal gram (or their products) which involve use of microbes.
Answer:

1. Wheat Product: Bread, cake etc.
2. Rice Product: Idli, dosa etc.
3. Bengal Gram Product: Dhokla, khandvi etc.

Question 5.
In which way have microbes played a m^jor role in controlling diseases caused by harmful bacteria?
Answer:
Several micro-organisms are used for preparing medicines. Antibiotics are medicines produced by certain micro-organisms to kill other disease-causing micro-organisms. These medicines are commonly obtained from bacteria and fungi. They either kill or stop the growth of disease-causing micro-organisms. Streptomycin, tetracycline, and penicillin are common antibiotics. Penicillium notatum produces chemical penicillin, which checks the growth of Staphylococci bacteria in the body. Antibiotics are designed to destroy bacteria by weakening their cell walls. As a result of this weakening, certain immune cells such as the white blood cells enter the bacterial cell and cause cell lysis. Cell lysis is the process of destroying cells such as blood cells and bacteria.

Question 6.
Name any two species of fungus, which are used in the production of the antibiotics.
Answer:
Antibiotics are medicines that are produced by certain micro-organisms to kill other disease-causing micro-organisms. These medicines are commonly obtained from bacteria and fungi.
The species of fungus used in the production of antibiotics are as follows:

Antibiotic	Fungus source
1. Penicillin	Penicillium notatum
2. Cephalosporin	Cephalosporium acremonium

Question 7.
What is sewage? In which way can sewage be harmful to us?
Answer:
Sewage is the municipal waste matter that is carried away in sewers and drains. It includes both liquid and solid wastes, rich in organic matter and microbes. Many of these microbes are pathogenic and can cause several water borne diseases. Sewage water is a major cause of polluting drinking water. Hence, it is essential that sewage water is properly collected, treated, and disposed. If untreated sewage is disposed into rivers and streams, it will pollute the water bodies.

Question 8.
What is the key difference between primary and secondary sewage treatment?
Answer:

Primary sewage treatment	Secondary sewage treatment
1. It is a mechanical process involving the removal of coarse solid materials.	It is a biological process involving the action of microbes.
2. It is inexpensive and relatively less complicated.	It is a very expensive and complicated process.

Question 9.
Do you think microbes can also be used as source of energy? If yes, how?
Answer:
Yes, microbes can be used as a source of energy. Bacteria such as Methane bacterium is used for the generation of gobar gas or biogas.

The generation of biogas is an anaerobic process in a biogas plant, which consists of a concrete tank (10-15 feet deep) with sufficient outlets and inlets. The dung is mixed with water to form the slurry and thrown into the tank. The digester of the tank is filled with numerous anaerobic methane-producing bacteria, which produce biogas from the slurry. Biogas can be removed through the pipe which is then used as a source of energy, while the spent slurry is removed from the outlet and is used as a fertiliser.

Question 10.
Microbes can be used to decrease the use of chemical fertilisers and pesticides. Explain how this can be accomplished.
Answer:
Microbes play an important role in organic farming, which is done without the use of chemical fertilisers and pesticides. Bio-fertilisers are living organisms which help increase the fertility of soil. It involves the ’ selection of beneficial micro-organisms that help in improving plant growth through the supply of plant nutrients. Bio-fertilisers are introduced in seeds, roots, or soil to mobilise the availability of nutrients. Thus, they are extremely beneficial in enriching the soil with organic nutrients. Many species of bacteria and cyanobacteria have the ability to fix free atmospheric nitrogen. Rhizobium is a symbiotic bacteria found in the root nodules of leguminous plants. Azpirillum and Azotobacter are free living nitrogen-fixing bacteria whereas Anabaena, Nostoc and Oscillatoria are examples of nitrogen-fixing cyanobacteria. Bio-fertilisers are cost effective and eco-friendly.

Microbes can also act as bio-pesticides to control insect pests in plants.
An example of bio-pesticides is Bacillus thuringiensis, which produces a toxin that kills the insect pests. Dried bacterial spores are mixed in water and sprayed in agricultural fields. When larvae of insects feed on crops, these bacterial spores enter the gut of the larvae and release r toxins, thereby it. Similarly, Trichoderma are free living fungi. They live in the roots of higher plants and protect them from various pathogens.

Baculoviruses is another bio-pesticide that is used as a biological control I agent against insects and other arthropods.

Question 11.
Three water samples namely river water, untreated sewage water and secondary effluent discharged from a sewage treatment plant were subjected to BOD test. The samples were labelled A, B and C; but the laboratory attendant did not note which was which. The BOD values of the three samples A, B and C were recorded as 20mg/L, 8mg/L and 400mg/L, respectively. Which sample of the water is most polluted? Can you assign the correct label to each assuming the river water is relatively clean?
Answer:
Biological oxygen demand (BOD) is the method of determining the amount of oxygen required by micro-organisms to decompose the waste present in the water supply. If the quantity of organic wastes in the water supply is high, then the number of decomposing bacteria present in the water will also be high. As a result, the BOD value will increase. Therefore, it can be concluded that if the water supply is more polluted, then it will have a higher BOD value. Out of the above three samples, sample C is the most polluted since it has the maximum BOD value of 400 mg/L.

After untreated sewage water, secondary effluent discharge from a sewage treatment plant is most polluted. Thus, sample A is secondary effluent discharge from a sewage treatment plant and has the BOD value of 20 mg/L, while sample B is river water and has the BOD value of 8 mg/L.
Hence, the correct label for each sample is:

Label	BOD value	Sample
A.	20 mg/L	Secondary effluent discharge from a sewage treatment plant
B.	8 mg/L	River water
C.	400 mg/L	Untreated sewage water

Question 12.
Find out the name of the microbes from which Cyclosporin A (an immunosuppressive drug) and Statins (blood cholesterol lowering agents) are obtained.
Answer:

Drug	Function	Microbe
1. Cyclosporin-A	Immuno suppressive drug	Trichoderma polysporum
2. Statin	Blood cholesterol lowering agent	Monascus purpureus

Question 13.
Find out the role of microbes in the following and discuss it with your teacher.
(a) Single cell protein (SCP)
(b) Soil
Answer:
(a) Single Cell Protein (SCP): A single cell protein is a protein obtained from certain microbes, which forms an alternate source of proteins in animal feeds. The microbes involved in the preparation of single cell proteins are algae, yeast, or bacteria. These microbes are grown on an industrial scale to obtain the desired protein. For example, Spirulina can be grown on waste materials obtained from molasses, sewage, and animal manures. It serves as a rich supplement of dietary nutrients such as proteins, carbohydrate, fats, minerals, and vitamins. Similarly, micro-organisms such as Methylophilus and methylotrophus have a large rate of biomass production. Their growth can produce a large amount of proteins.

(b) Soil: Microbes play an important role in maintaining soil fertility. They help in the formation of nutrient-rich humus by the process of decomposition. Many species of bacteria and cyanobacteria have the ability to fix atmospheric nitrogen into usable form. Rhizobium is a symbiotic bacteria found in the root nodules of leguminous plants. Azospirillum and Azotobacter are free living nitrogen-fixing bacteria, whereas Anabaena, Nostoc, and Oscillatoria are examples of nitrogen-fixing cyanobacteria.

Question 14.
Arrange the following in the decreasing order (most important first) of their importance, for the welfare of human society. Give reasons for your answer.
Biogas, Citric acid, Penicillin and Curd
Answer:
The order of arrangement of products according to their decreasing importance is :
Penicillin > Biogas > Citric acid > Curd
Penicillin is the most important product for the welfare of human society. It is an antibiotic, which is used for controlling various bacterial diseases. The second most important product is biogas. It is aneco-friendly source of energy. The next important product is citric acid, which is used as a food preservative. The least important product is curd, a food item obtained by the action of Lactobacillus bacteria on milk.

Question 15.
How do biofertilisers enrich the fertility of the soil?
Answer:
Bio-fertilisers are living organisms which help in increasing the fertility of soil. It involves the selection of beneficial micro-organisms that help in improving plant growth through the supply of plant nutrients. These are introduced to seeds, roots, or soil to mobilise the availability of nutrients by their biological activity. Thus, they are extremely beneficial jf in enriching the soil with organic nutrients. Many species of bacteria and cyanobacteria have the ability to fix free atmospheric nitrogen. Rhizobium is a symbiotic bacteria found in the root nodules of leguminous plants. Azospirillum and Azotobacter are free living nitrogen-fixing bacteria, whereas Anabaena, Nostoc, and Oscillatoria are examples of nitrogen-fixing cyanobacteria. Bio-fertilisers are cost effective and eco-friendly.

Punjab State Board PSEB 12th Class Biology Book Solutions Chapter 9 Strategies for Enhancement in Food Production Textbook Exercise Questions and Answers.

PSEB Solutions for Class 12 Biology Chapter 9 Strategies for Enhancement in Food Production

PSEB 12th Class Biology Guide Strategies for Enhancement in Food Production Textbook Questions and Answers

Question 1.
Explain in brief the role of animal husbandry in human welfare.
Answer:
Animal husbandry deals with the scientific management of livestock. It includes various aspects such as feeding, breeding, and control diseases to raise the population of animal livestock. Animal husbandry usually includes animals such as cattle, pig, sheep, poultry, honeybee, silkworm and fish which are useful for humans in various ways. These animals are managed for the production of commercially important products such as milk, meat, wool, egg, honey, silk, etc. The increase in human population has increased the demand of these products. Hence, it is necessary to improve the management of livestock scientifically.

Question 2.
If your family owned a dairy farm, what measures would you undertake to improve the quality and quantity of milk production?
Answer:
Dairy farm management deals with processes which aim at improving the quality and quantity of milk production. Milk production is primarily dependent on choosing improved cattle breeds, provision of proper feed for cattle, maintaining proper shelter facilities, and regular cleaning of cattle.

Choosing improved cattle breeds is an important factor of cattle management. Hybrid cattle breeds are produced for improved productivity. Therefore, it is essential that hybrid cattle breeds should have a combination of various desirable genes such as high milk production and high resistance to diseases. Cattle should also be given healthy and nutritious food consisting of roughage, fibre concentrates, and high levels of proteins and other nutrients.

Cattle should be housed in proper cattle-houses and should be kept in well ventilated roofs to prevent them from harsh weather conditions such as heat, cold, and rain. Regular baths and proper brushing should be ensured to control diseases. Also, time-to-time check ups by a veterinary doctor for symptoms of various diseases should be undertaken.

Question 3.
What is meant by the term ‘breed’? What are the objectives of animal breeding?
Answer:
A breed is a special variety of animals within a species. It is similar in most characters such as general appearance, size, configuration, and features with other members of the same species. Jersey and Brown
Swiss are examples of foreign breeds of cattle. These two varieties of cattle have the ability to produce abundant quantities of milk. This milk is very nutritious with high protein content.
Objectives of animal breeding are as follows:

• To increase thd yield of animals.
• To improve the desirable qualities of the animal produce.
• To produce disease-resistant varieties of animals.

Question 4.
Name the methods employed in animal breeding. According to you which of the methods is best? Why?
Answer:
Animal breeding is the method of mating closely related individuals. There are several methods employed in animal breeding, which can be classified into the following categories:

(A) Natural Methods of Breeding Include Inbreeding and Out-breeding : Breeding between animals of the same breed is known as inbreeding, while breeding between animals of different breeds is known as out-breeding. Out-breeding of animals is of three types:
(a) Out-crossing: In this type of out-breeding, the mating of animals occurs within the same breed. Thus, they have no common ancestors up to the last 4-5 generations.

(b) Cross-breeding: In this type of out-breeding, the mating occurs between different breeds of the same species, thereby producing a hybrid.

(c) Interspecific hybridisation: In this type of out-breeding, the mating occurs between different species.

(B) Artificial Methods of Breeding Include Modern Techniques of Breeding : It involves controlled breeding experiments, which are of two types:
(a) Artificial insemination : It is a process of introducing the semen (collected from the male) into the oviduct or the uterus of the female body by the breeder. This method of breeding helps the breeder overcome certain problems faced in abnormal mating.

(b) Multiple ovulation embryo technology (MOET) : It is a technique for cattle improvement in which super-ovulation is induced by a hormone injection. Then, fertilisation is achieved by artificial insemination and early embryos are collected. Each of these embryos are then transplanted into the surrogate mother for further development of the embryo.

The best method to carry out animal breeding is the artificial method of breeding, which includes artificial insemination and MOET technology. These technologies are scientific in nature. They help overcome problems of normal mating and have a high success rate of crossing between mature males and females. Also, it ensures the production of hybrids with the desired qualities. This method is highly economical as a small amount of semen from the male can be used to inseminate several cattle.

Question 5.
What is apiculture? How is it important in our lives?
Answer:
Apiculture is the practise of bee-keeping for the production of various products such as honey, bee’s wax, etc. Honey is a highly nutritious food source and is used as an indigenous system of medicines. It is
useful in the treatment of many disorders such as cold, flu, and 1 dysentery. Other commercial products obtained from honey bees include bee’s wax and bee pollen. Bee’s wax is used for making cosmetics, polishes, and is even used in several medicinal preparations. Therefore, to meet the increasing demand of honey, people have started practicing bee-keeping on a large scale. It has become an f income generating activity for farmers since it requires a low investment and is labour intensive.

Question 6.
Discuss the role of fishery in enhancement of food production.
Answer:
Fishery is an industry which deals with catching, processing, and marketing of fishes and other aquatic animals that have a high economic value. Some commercially important aquatic animals are prawns, crabs, oysters, lobsters, and octopus. Fisheries play an important role in the Indian economy. This is because a large part of the Indian population is dependent on fishes as a source of food, which is both cheap and high in animal protein. Fishery is an employment generating industry especially for people staying in the coastal areas. Both fresh water fishes (such as Catla, Rohu, etc.) and marine fishes (such as tuna, mackerel, pomfret, etc.) are of high economic value.

Question 7.
Briefly describe various steps involved in plant breeding.
Answer:
Plant breeding is the process in which two genetically dissimilar varieties are purposely crossed to produce a new hybrid variety. As a result, characteristics from both parents can be obtained in the hybrid plant variety. Thus, it involves the production of a new variety with the desired characteristics such as resistance to diseases, climatic adaptability, and better productivity. The various steps involved in plant breeding are as follows:

(a) Collection of Genetic Variability: Genetic variability from various wild relatives of the cultivated species are collected to maintain the genetic diversity of a species. The entire collection of the diverse alleles of a gene in a crop is called the germplasm collection.

(b) Evaluation of Germplasm and Selection of Parents: The germplasm collected is then evaluated for the desirable genes. The selected plants with the desired genes are then used as parents in plant breeding experiments and are multiplied by the process of hybridisation.

(c) Cross-hybridisation between Selected Parents: The next step in plant breeding is to combine the desirable characters present in two different parents to produce hybrids. It is a tedious job as one has to ensure that the pollen grains collected from the male parent reach the stigma of the female parent.

(d) Selection of Superior Hybrids: The progenies of the hybrids having the desired characteristics are selected through scientific evaluation. The selected progenies are then self-pollinated for several generations to ensure homozygosity.

(e) Testing, Release, and Commercialisation of New Cultivars: The selected progenies are evaluated for characters such as yield, resistance to diseases, performance, etc. by growing them in research fields for at least three growing seasons in different parts of the country. After thorough testing and evaluation, the selected varieties are given to the farmers for growing in fields for a large-scale production.

Question 8.
Explain what is meant by biofortification.
Answer:
Biofortification is a process of breeding crops with higher levels of vitamins, minerals, proteins, and fat content. This method is employed to improve public health. Breeding of crops with improved nutritional quality is undertaken to improve the content of proteins, oil, vitamins, minerals, and micro-nutrients in crops. It is also undertaken to upgrade the quality of oil and proteins. An example of this is a wheat variety known as Atlas 66, which has high protein content in comparison to the existing wheat. In addition, there are several other improved varieties of crop plants such as rice, carrots, spinach etc. which have more nutritious value and more nutrients than the existing varieties.

Question 9.
Which part of the plant is best suited for making virus-free plants and why?
Answer:
Apical and axillary meristems of plants is used for making virus-free plants. In a diseased plant, only this region is not infected by the virus as compared to the rest of the plant region. Hence, the scientists remove axillary and apical meristems of the diseased plant and grow it in vitro to obtain a disease-free and healthy plant.
Virus-free plants of banana, sugarcane, and potato have been obtained using this method by scientists.

Question 10.
What is the major advantage of producing plants by micropropagation?
Answer:
Micropropagation is a method of producing new plants in a short duration using plant tissue culture.
Some major advantages of micropropagation are as follows:

• Micropropagation helps in the propagation of a large number of plants in a short span of time.
• The plants produced are identical to the mother plant.
• It leads to the production of healthier plantlets, which exhibit better disease-resisting powers.

Question 11.
Find out what the various components of the medium used for propagation of an explant in vitro are?
Answer:
The major components of medium used for propagation of explants in vitro are carbon sources such as sucrose, inorganic salts, vitamins, amino acids, water, agar-agar, and certain growth hormones such as auxins, gibberellins and cytokinins etc.

Question 12.
Name any five hybrid varieties of crop plants which have been developed in India.
Answer:
The five hybrid varieties of crop plants which have been developed in India are as follow:

Crop plant	Hybrid variety
Wheat	Sonalika and Kalyan Sona
Rice	Jaya and Ratna
Cauliflower	Pusa Shubhra and Pusa Snowball K-1
Cowpea	Pusa Komal
Mustard	Pusa Swarnim

Punjab State Board PSEB 12th Class Biology Book Solutions Chapter 8 Human Health and Disease Textbook Exercise Questions and Answers.

PSEB Solutions for Class 12 Biology Chapter 8 Human Health and Disease

PSEB 12th Class Biology Guide Human Health and Disease Textbook Questions and Answers

Question 1.
What are the various public health measures, which you would suggest as safeguard against infectious diseases?
Answer:
Public health measures are preventive measures which are taken to check the spread of various infectious diseases. These measures should be taken to reduce the contact with infectious agents.
Some of these methods are as follows:
1. Maintenance of Personal and Public Hygiene: It is one of the most important methods of preventing infectious diseases. This measure includes maintaining a clean body, consumption of healthy and nutritious food, drinking clean water, etc. Public hygiene includes proper disposal of waste material, excreta, periodic cleaning, and disinfection of water reservoirs.

2. Isolation: To prevent the spread of air-borne diseases such as pneumonia, chicken pox, tuberculosis, etc., it is essential to keep the infected person in isolation to reduce the chances of spreading these diseases.

3. Vaccination: Vaccination is the protection of the body from communicable diseases by administering some agent that mimics the microbe inside the body. It helps in providing passive immunisation to the body. Several vaccines are available against many diseases such as tetanus, polio, measles, mumps, etc.

4. Vector Eradication: Various diseases such as malaria, filariasis, dengue, and chikungunya spread through vectors. Thus, these diseases can be prevented by providing a clean environment and by preventing the breeding of mosquitoes. This can be achieved by not allowing water to stagnate around residential areas. Also, measures like regular cleaning of coolers, use of mosquito nets and insecticides such as malathion in drains, ponds, etc. can be undertaken to ensure a healthy environment. Introducing fish such as Gambusia in ponds also controls the breeding of mosquito larvae in stagnant water.

Question 2.
In which way has the study of biology helped us to control infectious diseases?
Answer:
Various advancements that have occurred in the field of biology have helped us gain a better understanding to fight against various infectious diseases. Biology has helped us study the life cycle of various parasites, pathogens, and vectors along with the modes of transmission of various diseases and the measures for controlling them. Vaccination programmes against several infectious diseases such as small pox, chicken pox, tuberculosis, etc. have helped to eradicate these diseases. Biotechnology has helped in the preparation of newer and safer drugs and vaccines. Antibiotics have also played an important role in treating infectious diseases.

Question 3.
How does the transmission of each of the following diseases take * place?
(a) Amoebiasis
(b) Malaria
(c) Ascariasis
(d) Pneumonia
Answer:

Disease	Causative organism	Mode of transmission
a. Amoebiasis	Entamoeba histolytica	It is a vector-borne disease that spreads by the means of contaminated food and water. The vector involved in the transmission of this disease is the housefly.
b. Malaria	Plasmodium sp.	It is a vector-borne disease that spreads by the biting of the female Anopheles mosquito.
c. Ascariasis	Ascaris lumbricoides	It spreads via contaminated food and water.
d. Pneumonia	Streptococcus pneumoniae	It spreads by the sputum of an infected person.

Question 4.
What measure would you take to prevent water-borne diseases?
Answer:
Water-borne diseases such as cholera, typhoid, hepatitis B, etc. spread by drinking contaminated water. These water-borne diseases can be prevented by ensuring proper disposal of sewage, excreta, periodic cleaning. Also, measures such as disinfecting community water reservoirs, boiling drinking water, etc. should be observed.

Question 5.
Discuss with your teacher what does ‘a suitable gene’ means, in the context of DNA vaccines.
Answer:
‘A suitable gene’ refers to a specific DNA segment which can be injected into the cells of the host body to produce specific proteins. This protein kills the specific disease-causing organism in the host body and provides immunity.

Question 6.
Name the primary and secondary lymphoid organs.
Answer:

• Primary lymphoid organs include the bone marrow and the thymus.
• Secondary lymphoid organs include the spleen, lymph nodes, tonsils, Peyer’s patches of small intestine, and appendix.

Question 7.
The following are some well-known abbreviations, which have been used in this chapter. Expand each one to its full form:
(a) MALT
(b) CMI
(c) AIDS
(d) NACO
(e) HIV
Answer:
(a) MALT: Mucosa-Associated Lymphoid Tissue
(b) CMI: Cell-Mediated Immunity
(c) AIDS: Acquired Immuno Deficiency Syndrome
(d) NACO: National AIDS Control Organisation
(e) HIV: Human Immuno Deficiency Virus

Question 8.
Differentiate the following and give examples of each:
(a) Innate and acquired immunity
(b) Active and passive immunity
Answer:
(a) Innate and acquired immunity

Innate immunity	Acquired immunity
1. It is a non-pathogen specific type of defense mechanism.	It is a pathogen specific type of defense mechanism.
2. It is inherited from parents and protects the individual since birth.	It is acquired after the birth of an individual.
3. It operates by providing barriers against the entry of foreign infectious agents.	It operates by producing primary and secondary responses, which are mediated by B-lymphocytes and T-lymphocytes.
4. It does not have a specific memory.	It is characterised by an immunological memory.

(b) Active and passive immunity

Active immunity	Passive immunity
1. It is a type of acquired immunity in which the body produces its own antibodies against disease-causing antigens.	It is a type of acquired immunity in which readymade antibodies are transferred from one individual to another.
2. It has a long lasting effect.	It does not have long lasting effect.
3. It is slow. It takes time in producing antibodies and giving responses.	It is fast. It provides immediate relief.
4. Injecting microbes through vaccination inside the body is an example of active immunity.	Transfer of antibodies present in the mother’s milk to the infant is an example of passive immunity.

Question 9.
Draw a well-labelled diagram of an antibody molecule.
Answer:

Question 10.
What are the various routes by which transmission of human i immuno-deficiency virus takes place?
Answer:
AIDS (Acquired Immuno-Deficiency Syndrome) is caused by the Human I Immuno-deficiency Virus (HIV).
It has the following modes of transmission:

• Unprotected sexual contact with an infected person.
• Transfusion of blood from an infected person to a healthy person.
• Sharing infected needles and syringes.
• From an infected mother to a child through the placenta.

Question 11.
What is the mechanism by which the AIDS virus causes . deficiency of immune system of the infected person?
Answer:
AIDS (Acquired Immuno-Deficiency Syndrome) is caused by the Human immuno-deficiency virus (HIV) via sexual or blood-blood contact. After entering the human body, the HIV virus attacks and enters the macrophages. Inside the macrophages, the RNA of the virus replicates ’ with the help of enzyme reverse transcriptase and gives rise to viral
DNA. Then, this viral DNA incorporates into the host DNA and directs the synthesis of virus particles. At the same time, HIV enters helper T-lymphocytes. It replicates and produces viral progeny there. These newly formed progeny viruses get released into the blood, attacking p other healthy helper T-lymphocytes in the body. As a result, the number of T-lymphocytes in the body of an infected person decreases progressively, thereby decreasing the immunity of a person.

Question 12.
How is a cancerous cell different from a normal cell?
Answer:

Normal cell	Cancerous cell
1. Normal cells show the property of contact inhibition. Therefore, when these cells come into contact with other cells, they stop dividing.	Cancerous cells lack the property of contact inhibition. Therefore, they continue to divide, thereby forming a mass of cells or tumor.
2. They undergo differentiation after attaining a specific growth.	They do not undergo differentiation.
3. These cells remain confined at a particular location.	These cells do not remain confined at a particular location. They move into neighbouring tissues and disturb its function.

Question 13.
Explain what is meant by metastasis.
Answer:
The property of metastasis is exhibited by malignant tumors. It is the pathological process of spreading cancerous cells to the different parts of the body. These cells divide uncontrollably, forming a mass of cells called tumor. From the tumor, some cells get sloughed off and enter into the blood stream. From the blood stream, these cells reach distant parts of the body and therefore, initiate the formation of new tumors by dividing actively.

Question 14.
List the harmful effects caused by alcohol/drug abuse.
Answer:
Alcohol and drugs have several adverse effects on the individual, his family, and the society.
A. Effects of Alcohol
Effects on the Individual: Alcohol has an adverse effect on the body of an individual. When an individual consumes excess alcohol, it causes damage to the liver and the nervous system. As a result, other symptoms such as depression, fatigue, aggression, loss of weight and appetite may also be observed in the individual. Sometimes, extreme levels of alcohol consumption may also lead to heart failure, resulting coma and death. Also, it is advisable for pregnant women to avoid alcohol as it may inhibit normal growth of the baby.

Effects on the Family: Consumption of excess alcohol by any family member can have devastating effects on the family. It leads to several domestic problems such as quarrels, frustrations, insecurity, etc. Effects on the Society:

• Rash behaviour
• Malicious mischief and violence
• Deteriorating social network
• Loss of interest in social and other activities

B. Effects of Drugs
Effects on the Individual: Drugs have an adverse effect on the central nervous system of an individual. This leads to the malfunctioning of several other organs of the body such as the kidney, liver, etc. The spread of HIV is most common in these individuals as they share common needles while injecting drugs in their body. Drugs have long-term side effects on both males and females. These side effects include increased aggressiveness, mood swings, and depression.

Effects on the Family and Society: A person addicted to drugs creates problems for his family and society. A person dependant on drugs becomes frustrated, irritated, and anti-social.

Question 15.
Do you think that friends can influence one to take alcohol/ drugs? If yes, how may one protect himself/herself from such an influence?
Answer:
Yes, friends can influence one to take drugs and alcohol. A person cart take the following steps for protecting himself/herself against alcohol/ drug abuse:
(a) Increase your willpower to stay away from alcohol and drugs. One should not experiment with alcohol for curiosity and fun.

• Avoid the company of friends who take drugs.
• Seek help from parents and peers. ‘
• Take proper knowledge and counselling about drug abuse. Devote your energy in other extra-curricular activities.
• Seek immediate professional and medical help from psychologists and psychiatrists if symptoms of depression and frustration become apparent.

Question 16.
Why is that once a person starts taking alcohol or drugs, it is difficult to get rid of this habit? Discuss it with your teacher. Ans. Drug and alcohol consumption has an inherent addictive nature associated with euphoria and a temporary feeling of well-being. Repeated intake of drugs increases the tolerance level of the body’s receptors, leading to more consumption of drugs.

A. Effects of Alcohol
Effects on the Individual: Alcohol has an adverse effect on the body of an individual. When an individual consumes excess alcohol, it causes damage to the liver and the nervous system. As a result, other symptoms such as depression, fatigue, aggression, loss of weight and appetite may al“so be observed in the individual. Sometimes, extreme levels of alcohol consumption may also lead to heart failure, resulting coma and death. Also, it is advisable for pregnant women to avoid alcohol as it may inhibit normal growth of the baby.

Effects on the Family: Consumption of excess alcohol by any family member can have devastating effects on the family. It leads to several domestic problems such as quarrels, frustrations, insecurity, etc. Effects on the Society:

• Rash behaviour
• Malicious mischief and violence
• Deteriorating social network
• Loss of interest in social and other activities

B. Effects of Drugs
Effects on the Individual: Drugs have an adverse effect on the central nervous system of an individual. This leads to the malfunctioning of several other organs of the body such as the kidney, liver, etc. The spread of HIV is most common in these individuals as they share common needles while injecting drugs in their body. Drugs have long-term side effects on both males and females. These side effects include increased aggressiveness, mood swings, and depression.

Effects on the Family and Society: A person addicted to drugs creates problems for his family and society. A person dependant on drugs becomes frustrated, irritated, and anti-social.

Question 15.
Do you think that friends can influence one to take alcohol/ drugs? If yes, how may one protect himself/herself from such an influence?
Answer:
Yes, friends can influence one to take drugs and alcohol. A person cart take the following steps for protecting himself/herself against alcohol/ drug abuse:

• Increase your willpower to stay away from alcohol and drugs. One should not experiment with alcohol for curiosity and fun.
• Avoid the company of friends who take drugs.
• Seek help from parents and peers.
• Take proper knowledge and counselling about drug abuse. Devote your energy in other extra-curricular activities.
• Seek immediate professional and medical help from psychologists and psychiatrists if symptoms of depression and frustration become apparent.

Question 16.
Why is that once a person starts taking alcohol or drugs, it is difficult to get rid of this habit? Discuss it with your teacher.
Answer:
Drug and alcohol consumption has an inherent addictive nature associated with euphoria and a temporary feeling of well-being. Repeated intake of drugs increases the tolerance’ level of the body’s receptors, leading to more consumption of drugs.

Question 17.
In your view what motivates youngsters to take to alcohol or drugs and how can this be avoided?
Answer:
Many factors are responsible for motivating youngsters towards alcohol or drugs. Curiosity, need for adventure and excitement, experimentation are the initial causes of motivation. Some youngsters start consuming drugs and alcohol in order to overcome negative emotions (such as stress, pressure, depression, frustration) and to excel in various fields. Several mediums like television, internet, newspaper, movies etc. are also responsible for promoting the idea of alcohol to the younger generation. Amongst these factors, reasons such as unstable and unsupportive family structures and peer pressure can also lead an individual to be dependant on drugs and alcohol.

Preventive measures against addiction of alcohol and drugs are as follows:

• Parents should motivate and try to increase the willpower of their child.
• Parents should educate their children about the ill-effects of alcohol. They should provide them with proper knowledge and counselling regarding the consequences of addiction to alcohol.
• It is the responsibility of the parent to discourage a child from experimenting with alcohol. Youngsters should be kept away from the company of friends who consume drugs.
• Children should be encouraged to devote their energy in other extra¬curricular and recreational activities.
• Proper professional and medical help should be provided to a child if sudden symptoms of depression and frustration are observed.

Punjab State Board PSEB 12th Class Biology Book Solutions Chapter 7 Evolution Textbook Exercise Questions and Answers.

PSEB Solutions for Class 12 Biology Chapter 7 Evolution

PSEB 12th Class Biology Guide Evolution Textbook Questions and Answers

Question 1.
Explain antibiotic resistance observed in bacteria in light of Darwinian selection theory.
Answer:
Darwinian selection theory states that individuals with favourable variations are better adapted than individuals with less favourable variation. It means that nature selects the individuals with useful variation as these individuals are better evolved to survive in the existing environment. An example of such selection is antibiotic resistance in bacteria. When bacterial population was grown on an agar plate containing antibiotic penicillin, the colonies that were sensitive to penicillin died, whereas one or few bacterial colonies that were resistant to penicillin survived.

This is because these bacteria had undergone chance mutation, which resulted in the evolution of a gene that made them resistant to penicillin drug. Hence, the resistant bacteria multiplied quickly as compared to non-resistant (sensitive) bacteria, thereby increasing their number. Hence, the advantage of an individual over other helps in the struggle for existence.

Question 2.
Find out from newspapers and popular science articles any new fossil discoveries or controversies about evolution.
Answer:
Fossils of dinosaurs have revealed the evolution of reptiles in Jurassic period. As a result of this, evolution of other animals such as birds and mammals has also been discovered. However, two unusual fossils recently unearthed in China have ignited a controversy over the evolution of birds. Confuciusomis is one such genus of primitive birds that were crow sized and lived during the Creataceous period in China.

Question 3.
Attempt giving a clear definition of the term species.
Answer:
Species can be defined as a group of organisms, which have the capability to interbreed in order to produce fertile offspring.

Question 4.
Try to trace the various components of human evolution (hint: brain size and function, skeletal structure, dietary preference, etc.)
Answer:
The various components of human evolution are as follows:
(i) Brain capacity
(ii) Posture
(iii) Food/dietary preference and other important features

Question 5.
Find out through internet and popular science articles whether animals other than man has self-consciousness.
Answer:
There are many animals other than humans, which have self-consciousness. An example of an animal being self-conscious is dolphins. They are highly intelligent. They have a sense of self and they also recognise others among themselves and others. They communicate with each other by whistles, tail-slapping, and other body movements.

Not only dolphins, there are certain other animals such as crow, parrot, chimpanzee, gorilla, orangutan, etc., which exhibit self-consciousness.

Question 6.
List 10 modern-day animals and using the internet resources link it to a corresponding ancient fossil. Name both.
Answer:
The modern-day animals and their ancient fossils are listed in the following table:

Animal	Fossil
1. Man	Ramapithecus
2. Horse	Eohippus
3. Dog	Leptocyon
4. amel	Protylopus
5. Elephant	Moerithers
6. Whale	Protocetus
7. Fish	Arandaspis
8. Tetrapods	Icthyostega
9. Bat	Archaeonycteris
10. Giraffe	Palaeotragus

Question 7.
Practise drawing various animals and plants.
Answer:
Ask your teachers and parents to suggest the names of plants and animals and practise drawing them. You can also take help from your book to find the names of plants and animals.

Question 8.
Describe one example of adaptive radiation.
Answer:
Adaptive radiation is an evolutionary process that produces new species from a single, rapidly diversifying lineage. This process occurs due to natural selection. An example of adaptive radiation is Darwin finches, found in Galapagos Island. A large variety of finches is present in Galapagos Island that arose from a single species, which reached this land accidentally. As a result, many new species have evolved, diverged, and adapted to occupy new habitats. These finches have developed different eating habits and different types of beaks to suit their feeding habits. The insectivorous, blood sucking, and other species of finches with varied dietary habits have evolved from a single seed eating finch ancestor.

Question 9.
Can we call human evolution as adaptive radiation?
Answer:
No, human evolution cannot be called adaptive radiation. This is because adaptive radiation is an evolutionary process that produces new species from a single, rapidly diversifying lineage, which is not the case with human evolution. Human evolution is a gradual process that took place slowly in time. It represents an example of anagenesis.

Question 10.
Using various resources such as your school Library or the internet and discussions with your teacher, trace the evolutionary stages of any one animal, say horse.
Answer:
The evolution of horse started with Eohippus during Eocene period. It involved the following evolutionary stages:

1. Gradual increase in body size
2. Elongation of head and neck region
3. Increase in the length of limbs and feet
4. Gradual reduction of lateral digits
5. Enlargement of third functional toe
6. Strengthening of the back
7. Development of brain and sensory organs
8. Increase in the complexity of teeth for feeding on grass

The evolution of horse is represented as follows:

Eohippus: It had a short head and neck. It had four functional toes and a splint of 1 and 5 on each hind limb and a splint of 1 and 3 in each forelimb. The molars were short crowned that were adapted for grinding the plant diet.

Mesohippus: It was slightly taller than Eohippus. It had three toes in each foot.

Merychippus: It had the size of approximately 100 cm. Although it still had three toes in each foot, but it could run on one toe. The side toe did not touch the ground. The molars were adapted for chewing the grass.

Pliohippus: It resembled the modern horse and was around 108 cm tall. It had a single functional toe with splint of 2nd and 4th in each limb.

Equus: Pliohippus gave rise to Equus or the modem horse with one toe in each foot. They have incisors for cutting grass and molars for grinding food.

Punjab State Board PSEB 12th Class Biology Book Solutions Chapter 6 Molecular Basis of Inheritance Textbook Exercise Questions and Answers.

PSEB Solutions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance

PSEB 12th Class Biology Guide Molecular Basis of Inheritance Textbook Questions and Answers

Question 1.
Group the following as nitrogenous bases and nucleosides:
Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine.
Answer:
Nitrogenous Bases: Adenine, thymine, uracil, and cytosine.
Nucleosides: Cytidine and guanosine.

Question 2.
If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine in the DNA.
Answer:
According to Chargaffs rule, the DNA molecule should have an equal ratio of pyrimidine (cytosine and thymine) and purine (adenine and guanine). It means that the number of adenine molecules is equal to thymine molecules and the number of guanine molecules is equal to cytosine molecules.
% A = % T and % G = % C
If double stranded DNA has 20% of cytosine, then according to the law, it would have 20% of guanine.
Thus, percentage of G + C content = 40%
The remaining 60% represents both A + T molecule. Since adenine and guanine are always present in equal numbers, the percentage of adenine molecule is 30%.

Question 3.
If the sequence of one strand of DNA is written as follows: 5-ATGCATGCATGCATGCATGCATGCATGC-3′
Write down the sequence of complementary strand in 5′ → 3′ direction.
Answer:
The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of DNA is
5′- ATGCATGCATGCATGCATGCATGCATGC – 3′
Then, the sequence of complementary strand in 5′-3′ direction will be
3′- TACGTACGTACGTACGTACGTACGTACG – 5′
Therefore, the sequence of nucleotides on DNA polypeptide in 5′-3′ direction is
5′- GCATGCATGCATGCATGCATGCATGCAT – 3′

Question 4.
If the sequence of the coding strand in a transcription unit is written as follows:
5′ – ATGCATGCATGCATGCATGCATGCATGC-3 Write down the sequence of mRNA.
Answer:
If the coding strand in a transcription unit is
5′ – ATGCATGCATGCATGCATGCATGCATGC-3′
Then, the template strand in 3′ to 5′ direction would be
3′ – TACGTACGTACGTACGTACGTACGTACG-5′
It is known that the sequence of mRNA is same as the coding strand of DNA.
However, in RNA, thymine is replaced by uracil.
Hence, the sequence of mRNA will be
5′ – AUGCAUGCAUGCAUGCAUGCAUGCAUGC-3′

Question 5.
Which property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication? Explain.
Answer:
Watson and Crick observed that the two strands of DNA are f anti-parallel and complementary to each other with respect to their base sequences. This type of arrangement in DNA molecule led to the hypothesis that DNA replication is semi-conservative. It means that the double stranded DNA molecule separates and then, each of the separated strand acts as a template for the synthesis of a new complementary strand. As a result, each DNA molecule would have one parental strand and a newly synthesised daughter strand.

Since only one parental strand is conserved in each daughter molecule, it is known as semi-conservative mode of replication.

Quetion 6.
Depending upon the chemical nature of the template (DNA or RNA) and the nature of nucleic acids synthesised from it (DNA or RNA), list the types of nucleic acid polymerases.
Answer:
There are two different types of nucleic acid polymerases.

1. DNA-dependent DNA polymerases
2. DNA-dependent RNA polymerases

The DNA-dependent DNA polymerases use a DNA template strand for synthesising a new strand of DNA, whereas DNA-dependent RNA polymerases use a DNA template strand for synthesising a new strand of RNA.

Question 7.
How did Hershey and Chase differentiate between DNA and protein in their experiment while proving that DNA is the genetic material?
Answer:
Hershey and Chase worked with bacteriophage and E.coli to prove that DNA is the genetic material. They used different radioactive isotopes to label DNA and protein coat of the bacteriophage.

They grew some bacteriophages on a medium containing radioactive phosphorus (³²) to identify DNA and some on a medium containing radioactive sulphur (³⁵S) to identify protein. Then, these radioactive labelled phages were allowed to infect E.coli bacteria. After infecting, the protein coat of the bacteriophage was separated’from the bacterial cell by blending and then subjected to the process of centrifugation. Since the protein coat was lighter, it was found in the supernatant while the infected bacteria got settled at the bottom of the centrifuge tube. Hence, it was proved that DNA is the genetic material as it was transferred from virus to bacteria.

Question 8.
Differentiate between the following :
(a) Repetitive DNA and Satellite DNA
(b) mRNA and tRNA
(c) Template strand and Coding strand Arts,
Answer:
(a) Repetitive DNA and Satellite DNA

Repetitive DNA	Satellite DNA
Repetitive DNA are DNA sequences that contain small segments, which are repeated many times.	Satellite DNA are DNA sequences that contain highly repetitive DNA.

(b) mRNA and tRNA

mRNA	tRNA
1. mRNA or messenger RNA acts as a template for the process of transcription.	tRNA or transfer RNA acts as an adaptor molecule that carries a specific amino acid to mRNA for the synthesis of polypeptide.
2. It is a linear molecule.	It has clover leaf shape.

(c) Template strand and Coding strand

Template strand	Coding strand
1. Template strand of DNA acts as a template for the synthesis of mRNA during transcription.	Coding strand is a sequence of DNA that has the same base sequence as that of mRNA (except thymine that is replaced by uracil in DNA).
2. It runs from 3′ to 5′.	It runs from 5′ to 3′.

Question 9.
List two essential roles of ribosome during translation.
Answer:
The important functions of ribosome during translation are as follows :
(a) Ribosome acts as the site where protein synthesis takes place from individual amino .acids. It is made up of two subunits.
The smaller subunit comes in contact with mRNA and forms a protein synthesising complex whereas the larger subunit acts as an amino acid binding site.

(b) Ribosome acts as a catalyst for forming peptide bond. For example, 23s r-RNA in bacteria acts as a ribozyme.

Question 10.
In the medium where E. coli was growing, lactose was added, which induced the lac operon. Then, why does lac operon shut down some time after addition of lactose in the medium?
Answer:
Lac operon is a segment of DNA that is made up of three adjacent structural genes, namely, an operator gene, a promoter gene, and a regulator gene. It works in a coordinated manner to metabolise lactose into glucose and galactose.

In lac operon, lactose acts as an inducer. It binds to the repressor and inactivates it. Once the lactose binds to the repressor, RNA polymerase binds to the promoter region. Hence, three structural genes express their product and respective enzymes are produced. These enzymes act on lactose so that lactose is metabolised into glucose and galactose. After sometime, when the level of inducer decreases as it is completely metabolised by enzymes, it causes synthesis of the repressor from regulator gene. The repressor binds to the operator gene and prevents RNA polymerase from transcribing the operon. Hence, the transcription is stopped. This type of regulation is known as negative regulation.

Question 11.
Explain (in one or two lines) the function of the following:
(a) Promoter
(b) tRNA
(c) Exons
Answer:
(a) Promoter: Promoter is a region of DNA that helps in initiating the process of transcription. It serves as the binding site for RNA polymerase.

(b) tRNA: tRNA or transfer RNA is a small RNA that reads the genetic code present on mRNA. It carries specific amino acid to mRNA on ribosome during translation of proteins.

(c) Exons: Exons are coding sequences of DNA in eukaryotes that transcribe for proteins.

Question 12.
Why is the Human Genome project called a mega project?
Answer:
Human genome project was considered to be a mega project because it had a specific goal to sequence every base pair present in the human genome. It took around 13 years for its completion and got accomplished in year 2006. It was a large scale project, which aimed at developing new technology and generating new information in the field of genomic studies. As a result of it, several new areas and avenues have opened up in the field of genetics, biotechnology, and medical sciences. It provided clues regarding the understanding of human biology.

Question 13.
What is DNA fingerprinting? Mention its application.
Answer:
DNA fingerprinting is a technique used to identify and analyse the variations in various individuals at the level of DNA. It is based on variability and polymorphism in DNA sequences.
Applications

1. It is used in forensic science to identify potential crime suspects.
2. It is used to establish paternity and family relationships.
3. It is used to identify and protect the commercial varieties of crops and livestock.
4. It is used to find out the evolutionary history of an organism and trace out the linkages between groups of various organisms.

Question 14.
Briefly describe the following:
(a) Transcription
(b) Polymorphism
(c) Translation
(d) Bioinformatics
Answer:
(a) Transcription: It is the process of synthesis of RNA from DNA template. A segment of DNA gets copied into mRNA during the process. The process of transcription starts at the promoter region of the template DNA and terminates at the terminator region. The segment of DNA between these two regions is known as transcription unit. The transcription requires RNA polymerase enzyme, a DNA template, four types of ribonucleotides, and certain cofactors such as Mg²⁺.
The three important events that occur during the process of transcription are as follows:

1. Initiation
2. Elongation
3. Termination

The DNA-dependent RNA polymerase and certain initiation factors bind at the double stranded DNA at the promoter region of the template strand and initiate the process of transcription. RNA polymerase moves along the DNA and leads to the unwinding of DNA duplex into two separate strands. Then, one of the strands, called sense strand, acts as template for mRNA synthesis. The enzyme, RNA polymerase, utilises nucleoside triphosphates (dNTPs) as raw material and polymerises them to form mRNA according to the complementary bases present on the template DNA«. This process of opening of helix-and elongation of polynucleotide chain continues until the enzyme reaches the terminator region. As RNA polymerase reaches the terminator region, the newly synthesised mRNA transcripted along with enzyme is released. Another factor called terminator factor is required for the termination of the transcription.

(b) Polymorphism: It is a form of genetic variation in which distinct nucleotide sequence can exist at a particular site in a DNA molecule. This heritable mutation is observed at a high frequency in a population. It arises due to mutation either in somatic cell or in the germ cells. The germ cell mutation can be transmitted from parents to their offsprings. This results in accumulation of various mutations in a population, leading to variation and polymorphism in the population. This plays a very important role in the process of evolution and tracing human history.

(c) Translation: It is the process of polymerising amino acid to form a polypeptide chain. The triplet sequence of base pairs in mRNA defines the order and sequence of amino acids in a polypeptide chain.
The process of translation involves following three steps:

1. Initiation
2. Elongation
3. Termination

During the initiation of the translation, tRNA gets charged when the amino acid binds to it using ATP. The start (initiation) codon (AUG) present on mRNA is recognised only by the charged tRNA. The ribosome acts as an actual site for the process of translation and contains two separate sites in a large subunit for the attachment of subsequent amino acids. The small subunit of ribosome binds to mRNA at the initiation codon (AUG) followed by the large subunit. Then, it initiates the process of translation. During the elongation process, the ribosome moves one codon downstream along with mRNA so as to leave the space for binding of another charged tRNA. The amino acid brought by tRNA gets linked with the previous amino acid through a peptide bond and this process continues resulting in the formation of a polypeptide chain. When the ribosome reaches one or more STOP codon (VAA, UAG, and UGA), the process of translation gets terminated. The polypeptide chain is released and the ribosomes get detached from mRNA.

(d) Bioinformatics: It is the application of computational and statistical techniques to the field of molecular biology. It solves the practical problems arising from the management and analysis of biological data. The field of bioinformatics developed after the completion of human genome project (HGP). This is because enormous amount of data has been generated during the process of HGP that has to be managed and stored for easy access and interpretation for future use by various scientists. Hence, bioinformatics involves the creation of biological databases that store the vast information of biology.

It develops certain tools for easy and efficient access to the information and its utilisation. Bioinformatics has developed new algorithms and statistical methods to find out the relationship between the data, to predict protein structure and their functions, and to cluster the protein sequences into their related families.

Punjab State Board PSEB 12th Class Biology Book Solutions Chapter 5 Principles of Inheritance and Variation Textbook Exercise Questions and Answers.

PSEB Solutions for Class 12 Biology Chapter 5 Principles of Inheritance and Variation

PSEB 12th Class Biology Guide Principles of Inheritance and Variation Textbook Questions and Answers

Question 1.
Mention the advantages of selecting pea plant for experiment by Mendel.
Answer:
Mendel selected pea plants to carry out his study on the inheritance of characters from parents to offspring. He selected a pea plant because of the following features:

• Peas have many visible contrasting characters such as tall/dwarf plants, round/wrinkled seeds, green/yellow pod, purple/white flowers, etc.
• Peas have bisexual flowers and therefore undergo self pollination easily. Thus, pea plants produce offsprings with same traits generation after generation.
• In pea plants, cross pollination can be easily achieved by emasculation in which the stamen of the flower is removed without affecting the pistil.
• Pea plants have a short life span and produce many seeds in one generation.

Question 2.
Differentiate between the following:
Dominance and Recessive Homozygous and Heterozygous
(a) Dominance and Recessive
(b) Homozygous and Heterozygous
(c) Monohybrid and Dihybrid.
Answer:
(a) Dominance and Recessive

Dominance	Recessive
1. A dominant trait expresses itself in the presence or absence of a recessive trait.	A recessive trait is able to express itself only in the absence of a dominant trait.
2. For example, tall plant, round seed, violet flower, etc. are dominant traits in a pea plant.	For example, dwarf plant, wrinkled seed, white flower, etc. are recessive traits in a pea plant.

(b) Homozygous and Heterozygous

Homozygous	Heterozygous
1. It contains two similar alleles for a particular trait.	It contains two different alleles for a particular trait.
2. Genotype for homozygous possess either dominant or recessive, but never both the alleles. For example, RR or rr	Genotype for heterozygous possess both dominant and recessive alleles. For example, Rr
3. It produces only one type of gamete.	It produces two different types of gametes.

(c) Monohybrid and Dihybrid

Monohybrid	Dihybrid
1. Monohybrid involves cross between parents’, which differs in only one pair of contrasting characters.	Dihybrid involves cross between parents, which differs in two pairs of contrasting characters.
2. For example, the cross between tall and dwarf pea plant is a monohybrid cross.	For example, the cross between pea plants having yellow wrinkled seed with those having green round seeds is a dihybrid cross.

Question 3.
A diploid organism is heterozygous for 4 loci, how many types of gametes can be produced?
Answer:
Locus is a fixed position on a chromosome, which is occupied by a single or more genes. Heterozygous organisms contain different alleles for an allelic pair. Hence, a diploid organism, which is heterozygous at four loci, will have four different contrasting characters at four different loci.

For example, if an organism is heterozygous at four loci with four characters, say Aa, Bb, Cc, Dd, then during meiosis, it will segregate to form 8 separate gametes.

If the genes are not linked, then the diploid organism will produce 16 different gametes. However, if the genes are linked, the gametes will reduce their number as the genes might be linked and the linked genes will be inherited together during the process of meiosis.

Question 4.
Explain the Law of Dominance using a monohybrid cross.
Answer:
Mendel’s law of dominance states that a dominant allele expresses itself in a monohybrid cross and suppresses the expression of recessive allele. However, this recessive allele for a character is not lost and remains hidden or masked in the progenies of F₁ generation and reappears in the next generation.

For example, when pea plants with round seeds (RR) are crossed with plants with wrinkled seeds (rr), all seeds in F₁ generation were found to be round (Rr). When these round seeds were self fertilised, both the round and wrinkled seeds appeared in F₂ generation in 3 : 1 ratio. Hence, in F₂ generation, the dominant character (round seeds) appeared and the recessive character (wrinkled seeds) got suppressed, which reappeared in F₂ generation.

Question 5.
Define and design a test-cross.
Answer:
Test cross is a cross between an organism with unknown genotype and a recessive parent. It is used to determine whether the individual is homozygous or heterozygous for a trait.
If the progenies produced by a test cross show 50% dominant trait and 50% recessive trait, then the unknown individual is heterozygous for a trait. On the other hand, if the progeny produced shows dominant trait, then the unknown individual is homozygous for a trait.

Question 6.
Using a Punnett Square, workout the distribution of phenotypic features in the first filial generation after a cross between a homozygous female and a heterozygous male for a single locus.
Answer:
In guinea pigs, heterozygous male with black coat colour (Bb) is crossed with the homozygous female having white coat colour (bb). The male will produce two types of gametes, B and b, while the female will produce only one kind of gamete, b. The genotypic and phenotypic ratio in the progenies of Fx generation will be same i.e., 1:1.

Question 7.
When a cross is made between tall plant with yellow seeds (TtYy) and tall plant with green seed (Ttyy), what proportions of phenotype in the offspring could be expected to he
(a) tall and green.
(b) dwarf and green.
Answer:
A cross between tall plant with yellow seeds and tall plant with green seeds will produce
(a) three tall and green plants
(b) one dwarf and green plant

Question 8.
Two heterozygous parents are crossed. If the two loci are linked what would be the distribution of phenotypic features in F₁ generation for a dihybrid cross?
Answer:
When two individual heterozygous for two loci (Yy Rr) are crossed and the two loci are linked, the distribution of the phenotypic feature of F₁ generation will be in the ratio of 3:1 \(\frac{3}{4}\) of the individuals will show
both the dominant traits and \(\frac{1}{4}\) of the individuals will show both the
recessive traits. It is because the genes for both the traits are present on the same chro

Question 9.
Briefly mention the contribution of T.H. Morgan in genetics.
Answer:
Morgan’s work is based on fruit flies (Drosophila melanogaster). He formulated the chromosomal theory of linkage. He defined linkage as the co-existence of two or more genes in the same chromosome and performed dihybrid crosses in Drosophila to show that linked genes are inherited together and are located on X-chromosome. His experiments have also proved that tightly linked genes show very low recombination while loosely linked genes show higher recombination.

Question 10.
What is pedigree analysis? Suggest how such an analysis, can be useful.
Answer:
Pedigree analysis is a record of occurrence of a trait in several generations of a family. It is based on the fact that certain characteristic features are heritable in a family, for example, eye colour, skin colour, hair form and colour, and other facial characteristics. Along with these features, there are other genetic disorders such as Mendelian disorders that are inherited in a family, generation after generation. Hence, by using pedigree analysis for the study of specific traits or disorders, generation after generation, it is possible to trace the pattern of inheritance. In this analysis, the inheritance of a trait is represented as a tree, called family tree. Genetic counselors use pedigree chart for analysis of various traits and diseases in a family and predict their inheritance patterns. It is useful in preventing haemophilia, sickle cell anaemia, and other genetic disorders in the future generations.

Question 11.
How is sex determined in human beings?
Answer:
Human beings exhibit male heterogamy. In humans, males (XY) produce two different types of gametes, X and Y. The human female (XX) produces only one type of gametes containing X chromosomes. The sex of the baby is determined by the type of male gamete that fuses with the female gamete. If the fertilising sperm contains X chromosome, then the baby produced will be a girl and if the fertilising sperm contains Y chromosome, then the baby produced will be a boy. Hence, it is a matter of chance that determines the sex of a baby. There is an equal probability of the fertilising sperm being an X or Y chromosome. Thus, it is the genetic make up of the sperm that determines the sex of the baby.

Question 12.
A child has hlood group O. If the father has hlood group A and mother blood group B, work out the genotypes of the parents and the possible genotypes of the other offsprings.
Answer:
The blood group characteristic in humans is controlled by three set of alleles, namely, I^A,I^B and i. The alleles, I^A and I^B, are equally dominant whereas allele, i, is recessive to the other alleles. The individuals with genotype, I^A I^A and I^A i, have blood group A whereas the individuals with genotype, I^B I^B and I^B i, have blood group B. The persons with genotype I^A I^B have blood group AB while those with blood group O have genotype ii.
Hence, if the father has blood group A and mother has blood group B, then the possible genotype of the parents will be
Father
I^AI ^{or A}I^Ai

Mother
I^BI^B or I^Bi
A cross between homozygous parents will produce progeny with AB blood group.

A cross between heterozygous parents will produce progenies with AB blood group (I^A I^B) and O blood group (ii).

Question 13.
Explain the following terms with example
(a) Co-dominance
(b) Incomplete dominance
Answer:
(a) Co-dominance: Co-dominance is the phenomenon in which both the alleles of a contrasting character are expressed in heterozygous condition. Both the alleles of a gene are equally dominant. ABO blood group in human beings is an example of co-dominance. The blood group character is controlled by three sets of alleles, namely, I^A, I^B, and i. The alleles, I^A and I^B, are equally dominant and are said to be co-dominant as they are expressed in AB blood group. Both these alleles do not interfere with the expression of each other and produce their respective antigens. Hence, AB blood group is an example of co-dominance.

(b) Incomplete Dominance: Incomplete dominance is a phenomenon in which one allele shows incomplete dominance over the other member of the allelic pair for a character. For example, a monohybrid cross between the plants having red flowers and white flowers in Antirrhinum species will result in all pink flower plants in Fj generation. The progeny obtained in Fx generation does not resemble either of the parents and exhibits intermediate characteristics. This is because the dominant allele, R, is partially dominant over the other allele, r. Therefore, the recessive allele, r, also gets expressed in the generation resulting in the production of intermediate pink flowering progenies with Rr genotype.

What is point mutation? Give one example.
Answer:
Point mutation is a change in a single base pair of DNA by substitution, deletion, or insertion of a single nitrogenous base. An example of point mutation is sickle cell anaemia. It involves mutation in a single base pair in the beta-globin chain of haemoglobin pigment of the blood. Glutamic acid in short arm of chromosome II gets replaced with valine at the sixth position.

Question 15.
Who had proposed the chromosomal theory of the inheritance?
Answer:
Sutton and Boveri proposed the chromosomal theory of inheritance in 1902. They linked die inheritance of traits to the chromosomes.

Question 16.
Mention any two autosomal genetic disorders with their symptoms.
Answer:
Two autosomal genetic disorders are as follows:
1. Sickle Cell Anaemia: It is an autosomal linked recessive disorder, which is caused by point mutation in the beta-globin chain of haemoglobin pigment of the blood. The disease is characterised by sickle shaped red blood cells, which are formed due to the mutant haemoglobin molecule. The disease is controlled by Hb^A and Hb^S allele. The homozygous individuals with genotype, Hb^SHb^S, show the symptoms of this disease while the heterozygous individuals with genotype, Hb^A Hb^S, are not affected. However, they act as carriers of the disease.

Symptoms: Rapid heart rate, breathlessness, delayed growth and puberty, jaundice, weakness, fever, excessive thirst, chest pain, and decreased fertility are the major symptoms of sickle cell anaemia disease.

(b) Down’s Syndrome: It is an autosomal disorder that is caused by the trisomy of chromosome 21.
Symptoms : The individual is short statured with round head, open mouth, protruding tongue, short neck, slanting eyes, and broad short hands. The individual also shows retarded mental and physical growth.